circad | circRNAs associated with diseases

Circular RNA-100290
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Acute Myeloid Leukemia	ICD-10	Mature B-cell leukaemia Burkitt-type (C91.8)
DBLink		PMID	30424877
Experimental Method
Sample Type	Bone marrow cells	Comparison	60 AML and healthy bone marrow cells
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTCATTCCCTCTTTAATGGTG Reverse CAGAACTTCCGCTCTAACA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Fan, H, Li, Y, Liu, C, Liu, Y, Bai, J, Li, W (2018). Circular RNA-100290 promotes cell proliferation and inhibits apoptosis in acute myeloid leukemia cells via sponging miR-203. Biochem. Biophys. Res. Commun., 507, 1-4:178-184.